DC Field | Value | Language |
---|---|---|
dc.contributor.author | Song, KM | - |
dc.contributor.author | Cho, M | - |
dc.contributor.author | Jo, H | - |
dc.contributor.author | Min, K | - |
dc.contributor.author | Jeon, SH | - |
dc.contributor.author | Kim, T | - |
dc.contributor.author | Han, MS | - |
dc.contributor.author | Ku, JK | - |
dc.contributor.author | Ban, C | - |
dc.date.accessioned | 2016-03-31T09:29:22Z | - |
dc.date.available | 2016-03-31T09:29:22Z | - |
dc.date.created | 2011-08-11 | - |
dc.date.issued | 2011-08-15 | - |
dc.identifier.issn | 0003-2697 | - |
dc.identifier.other | 2011-OAK-0000023957 | - |
dc.identifier.uri | https://oasis.postech.ac.kr/handle/2014.oak/17253 | - |
dc.description.abstract | A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K-d [kanamycin] = 78.8 nM, K-d [kanamycin B] = 84.5 nM, and K-d [tobramycin] = 103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5'-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products. (C) 2011 Elsevier Inc. All rights reserved. | - |
dc.description.statementofresponsibility | X | - |
dc.language | English | - |
dc.publisher | ACADEMIC PRESS INC ELSEVIER SCIENCE | - |
dc.relation.isPartOf | ANALYTICAL BIOCHEMISTRY | - |
dc.subject | ssDNA aptamer | - |
dc.subject | SELEX | - |
dc.subject | Colorimetry | - |
dc.subject | Gold nanoparticle | - |
dc.subject | Kanamycin | - |
dc.subject | IN-VITRO SELECTION | - |
dc.subject | RNA APTAMERS | - |
dc.subject | SMALL MOLECULES | - |
dc.subject | SELEX | - |
dc.subject | CHLORAMPHENICOL | - |
dc.subject | ANTIBIOTICS | - |
dc.subject | LIGANDS | - |
dc.subject | AMPLIFICATION | - |
dc.subject | IMMUNOSENSOR | - |
dc.subject | THERAPEUTICS | - |
dc.title | Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer | - |
dc.type | Article | - |
dc.contributor.college | 화학과 | - |
dc.identifier.doi | 10.1016/J.AB.2011.04.007 | - |
dc.author.google | Song, KM | - |
dc.author.google | Cho, M | - |
dc.author.google | Jo, H | - |
dc.author.google | Min, K | - |
dc.author.google | Jeon, SH | - |
dc.author.google | Kim, T | - |
dc.author.google | Han, MS | - |
dc.author.google | Ku, JK | - |
dc.author.google | Ban, C | - |
dc.relation.volume | 415 | - |
dc.relation.issue | 2 | - |
dc.relation.startpage | 175 | - |
dc.relation.lastpage | 181 | - |
dc.contributor.id | 10085220 | - |
dc.relation.journal | ANALYTICAL BIOCHEMISTRY | - |
dc.relation.index | SCI급, SCOPUS 등재논문 | - |
dc.relation.sci | SCI | - |
dc.collections.name | Journal Papers | - |
dc.type.rims | ART | - |
dc.identifier.bibliographicCitation | ANALYTICAL BIOCHEMISTRY, v.415, no.2, pp.175 - 181 | - |
dc.identifier.wosid | 000291904700011 | - |
dc.date.tcdate | 2019-01-01 | - |
dc.citation.endPage | 181 | - |
dc.citation.number | 2 | - |
dc.citation.startPage | 175 | - |
dc.citation.title | ANALYTICAL BIOCHEMISTRY | - |
dc.citation.volume | 415 | - |
dc.contributor.affiliatedAuthor | Ku, JK | - |
dc.contributor.affiliatedAuthor | Ban, C | - |
dc.identifier.scopusid | 2-s2.0-79958258087 | - |
dc.description.journalClass | 1 | - |
dc.description.journalClass | 1 | - |
dc.description.wostc | 189 | - |
dc.description.scptc | 174 | * |
dc.date.scptcdate | 2018-05-121 | * |
dc.type.docType | Article | - |
dc.subject.keywordPlus | IN-VITRO SELECTION | - |
dc.subject.keywordPlus | RNA APTAMERS | - |
dc.subject.keywordPlus | SELEX | - |
dc.subject.keywordPlus | ANTIBIOTICS | - |
dc.subject.keywordPlus | CHLORAMPHENICOL | - |
dc.subject.keywordPlus | IMMUNOSENSOR | - |
dc.subject.keywordPlus | MOLECULES | - |
dc.subject.keywordPlus | BIOSENSOR | - |
dc.subject.keywordPlus | LIGANDS | - |
dc.subject.keywordAuthor | ssDNA aptamer | - |
dc.subject.keywordAuthor | SELEX | - |
dc.subject.keywordAuthor | Colorimetry | - |
dc.subject.keywordAuthor | Gold nanoparticle | - |
dc.subject.keywordAuthor | Kanamycin | - |
dc.relation.journalWebOfScienceCategory | Biochemical Research Methods | - |
dc.relation.journalWebOfScienceCategory | Biochemistry & Molecular Biology | - |
dc.relation.journalWebOfScienceCategory | Chemistry, Analytical | - |
dc.description.journalRegisteredClass | scie | - |
dc.description.journalRegisteredClass | scopus | - |
dc.relation.journalResearchArea | Biochemistry & Molecular Biology | - |
dc.relation.journalResearchArea | Chemistry | - |
Items in DSpace are protected by copyright, with all rights reserved, unless otherwise indicated.
library@postech.ac.kr Tel: 054-279-2548
Copyrights © by 2017 Pohang University of Science ad Technology All right reserved.